翻页电子书制作,电子书制作,电子杂志制作

欢迎来到云展网,国内唯一的3D翻页电子书免费发布、阅读平台。上传PDF即可转换为翻页电子书!

19. Requirement of cytosolic phospholipase A2 gamma in lipid droplet formation—翻页版预览

阅读,搜索本杂志文字内容 点击阅读
阅读云展网其他3D杂志 点击阅读
点击进入免费阅读翻页书版本
喜欢这样的3D电子杂志?您也可以在几分钟内把文档免费上传到云展网变成翻页书![点击上传我的文档]
8787 上传于 2018-09-07 12:59:03

19. Requirement of cytosolic phospholipase A2 gamma in lipid droplet formation

BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

Contents lists available at ScienceDirect

BBA - Molecular and Cell Biology of Lipids

journal homepage: www.elsevier.com/locate/bbalip

Requirement of cytosolic phospholipase A2 gamma in lipid droplet MARK

formation

Xi Sua,b, Shuhui Liua,b, Xianwen Zhanga,b, Sin Man Lamd, Xue Hua, Yuan Zhoua, Jizheng Chena,
Yun Wanga, Chunchen Wua, Guanghou Shuid, Mengji Luc, Rongjuan Peia,⁎, Xinwen Chena,b,⁎

a State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China
b University of Chinese Academy of Sciences, Beijing, China
c Department of Infectious Disease, University Hospital Essen, University of Duisburg-Essen, Essen, Germany
d State Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

ARTICLE INFO ABSTRACT

Keywords: Lipid droplet (LD) accumulation in hepatocytes is a typical character of steatosis. Hepatitis C virus (HCV)
Lipid droplet infection, one of the risk factors related to steatosis, induced LD accumulation in cultured cells. However, the
HCV mechanisms of which HCV induce LD formation are not fully revealed. Previously we identified cytosolic
Cytosolic phospholipase A2 gamma phospholipase A2 gamma (PLA2G4C) as a host factor upregulated by HCV infection and involved in HCV
PLA2G4C replication. Here we further revealed that PLA2G4C plays an important role in LD biogenesis and refined the
Assemble functional analysis of PLA2G4C in LD biogenesis and HCV assembly. LD formation upon fatty acid and HCV
Steatosis stimulation in PLA2G4C knockdown cells was impaired and could not be restored by complementation with
PLA2G4A. PLA2G4C was tightly associated in the membrane with the domain around the amino acid residues
260–292, normally in ER but relocated into LDs upon oleate stimulation. Mutant PLA2G4C without enzymatic
activity was not able to restore LD formation in PLA2G4C knockdown cells. Thus, both the membrane
attachment and the enzymatic activity of PLA2G4C were required for its function in LD formation. The
participation of PLA2G4C in LD formation is correlated with its involvement in HCV assembly. Finally, PLA2G4C
overexpression itself led to LD formation in hepatic cells and enhanced LD accumulation in the liver of high-fat
diet (HFD)-fed mice, suggesting its potential role in fatty liver disease.

1. Introduction are formed remain largely unexplored. The prevailing model hypothe-
sizes that LDs biogenesis is a process including the deposition of neutral
Lipid droplets (LDs) are dynamic cytoplasmic organelles composed lipid between the leaflets of the ER bilayer membrane, a budding and
of a core of neutral lipids (triacylglycerol and cholesterol esters) and a fission of the nascent LDs [12]. During the budding and fission process,
phospholipid monolayer membrane that is decorated with many both positive and negative membrane curvature which is generated by
integral or peripherally associated proteins [1]. In addition to their phospholipids and proteins are required [13]. The LD-associated
energy storage capacity, LDs are found to be implicated in numerous proteins such as the perilipins and the cell death-inducing DFF45-like
processes such as lipid synthesis and metabolism, membrane trafficking effector (CIDE) family proteins are essential for LD biogenesis and for
and signal transduction [2–4]. Accumulating studies also show that LDs maintaining LD morphology [14–16]. The LD-associated proteins are
are involved in the replication of several viruses [5–7], including also required in performing LD functions, for example, several enzymes
hepatitis C virus (HCV), dengue virus (DENV) and rotavirus (RV), and including cytosolic phospholipase A2 alpha participated in the eicosa-
are implicated in the pathogenesis of numerous diseases, such as noid biosynthesis are associated with LDs, thus LDs are supposed to
hepatic steatosis, type 2 diabetes, atherosclerosis and metabolic syn- function as the eicosanoid synthesis platform [17].
drome [8–11].
As one of the main causes of liver steatosis, HCV infection induces a
Although it is generally believed that LDs originate from the significant increase and accumulation of LDs in hepatocytes [18]. The
endoplasmic reticulum (ER), the detailed mechanisms by which LDs HCV Core and NS5A proteins are translocated from the ER to LDs

Abbreviations: PLA2G4C, cytosolic phospholipase A2 gamma; HCV, Hepatitis C virus; LD, lipid droplet; ER, endoplasmic reticulum; shRNA, short hairpin RNA; ORO, Oil Red O; H & E,
hematoxylin and eosin; NS, no significant difference

⁎ Corresponding authors at: State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China.
E-mail addresses: rongjuan_pei@wh.iov.cn (R. Pei), chenxw@wh.iov.cn (X. Chen).

http://dx.doi.org/10.1016/j.bbalip.2017.03.007
Received 30 November 2016; Received in revised form 16 March 2017; Accepted 18 March 2017
Available online 21 March 2017
1388-1981/ © 2017 Elsevier B.V. All rights reserved.

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

during virus replication, and their association with LDs is essential for of aa 260–292 in PLA2G4C, was constructed by fusion PCR. All
virion assembly [19]. Several host factors that have been identified to constructs were confirmed by sequencing. Transfections with the
be LD-associated proteins, such as DGAT1, TIP47 and Rab18, can plasmid DNA were carried out with Lipofectamine 2000 (Invitrogen)
enhance the association of Core or NS5A with LDs and facilitate HCV following the manufacturer's instructions.
virion assembly [19–21]. The HCV RNA could be sensed by DEAD box
polypeptide 3, X-linked (DDX3X), which then activates IKK-α and 2.4. Generation of PLA2G4C knockdown cell lines
finally induces the sterol regulatory element-binding proteins
(SREBPs)-mediated lipogenesis and LD formation [22]. The Core The coding sequences for the short hairpin RNAs (shRNAs) targeting
protein is another key viral component that induces LD formation, as the PLA2G4C gene (GTGCTCTTGGTAACACTGAAGTCATTAGG) were
overexpression of Core alone can elevate the LD content in cells, and cloned into the pLKO.1 backbone (Addgene, 10878), and a scrambled
Core transgenic mice develop steatosis [23,24]. Although most studies shRNA was used as a negative control (Addgene, 1864). To obtain the
have focused on the metabolism changes in lipid synthesis in HCV- lentiviral virus, HEK293T cells were transfected with the corresponding
infected cells, less attention has been paid to the modulation of proteins pLKO.1 constructs, psPAX2 packaging vectors (Addgene, 12260) and
required for LD biogenesis. In addition, growing numbers of proteins envelope plasmid pMD2.G (Addgene, 12259). The supernatants were
have been identified as LD-associated proteins and are related to harvested at 48 and 72 h post-transfection (hpt), filtered through a
steatosis [25], for example, the CIDE family proteins Cidea, Cideb 0.45 μm syringe filter (Millipore), and stored at −80 °C. To generate
and Cidec/Fsp27 are closely linked to liver steatosis [26]. However, the PLA2G4C stable knockdown and control cell lines, Huh7.5.1 cells
little is known about the role of these proteins in the infection and were transduced with the corresponding lentivirus in the presence of
pathogenesis of HCV. 8 mg/ml polybrene (Sigma) followed by puromycin selection.

We previously identified cytosolic phospholipase A2 gamma 2.5. Lentiviral transduction for gene expression
(PLA2G4C) which is upregulated significantly by HCV infection as a
host factor important for HCV RNA replication and assembly [27]. In The sequences encoding PLA2G4C-HA, mPLA2G4C—HA and
this report, we further revealed that PLA2G4C participated in LD PLA2G4CΔ260–292-HA were cloned into the pLVTH lentiviral expression
biogenesis induced by HCV infection and by fatty acid stimulation. vector (Addgene, 12262) using PmeI and SpeI restriction sites. The HA
PLA2G4C translocated from the ER to LDs during LD formation, and the tag was subcloned into the same vector as a negative control. To obtain
membrane attachment, as well as the enzymatic activity of PLA2G4C, the lentiviral virus, HEK293T cells were transfected with the corre-
was required for LD formation. Restoration of the PLA2G4C expression sponding pLVTH constructs, pCMV-ΔR8.91, and pMD2G-VSVG. The
in stable knockdown cells rescued LD formation, accompanied with the supernatants were harvested at 48 and 72 hpt, filtered through a
rescue of HCV assembly efficiency. Furthermore, overexpression of 0.45 μm syringe filter (Millipore), and mixed with polybrene (8 mg/
PLA2G4C in the liver of high-fat diet (HFD)-fed mice promoted lipid ml) for cell transduction or stored at −80 °C.
deposition in hepatocytes in vivo.
2.6. Oleate loading
2. Material and methods
Oleate was first complexed with BSA (Sangon Biotech, A602440). A
2.1. Cell culture and virus 10% w/v solution of BSA in DMEM containing 2.5 mM oleate was
prepared as a stock solution. The final incubation with the cells
Huh7.5.1 cells and HEK293T cells were cultured in Dulbecco's contained 2% BSA and 0.5 mM oleate [29].
Modified Eagle's Medium (DMEM) (Gibco) supplemented with 10%
fetal bovine serum (FBS) (Gibco), nonessential amino acids, 100 U/ml 2.7. RNA extraction and quantification
penicillin, and 100 U/ml streptomycin at 37 °C in 5% CO2. The HCV
viral stock, J399EM, was prepared and titered as previously described Total RNA, from intracellular or supernatant, was isolated using the
[28]. TRIzol or TRIzolLS reagents (Invitrogen), respectively, according to the
manufacturer's protocols. The quantification was performed using a
2.2. Antibodies and reagents QuantiTect SYBR Green RT-PCR kit (Qiagen, 204245) on the ABI
StepOne Real-Time PCR System (Applied Biosystems). The copy
The antibodies used in this study were commercially available: anti- number of specific mRNA was normalized to the mRNA level of beta-
HA (H9658), anti-FLAG (F1804), and anti-beta-actin (A2066) were actin in each sample. All experiments were performed in triplicate and
from Sigma; anti-NS3 (ab65407) and anti-Core (ab2740) were from were repeated at least three times. The primers used for RT-PCR
Abcam; anti-calnexin (#2679) was from Cell Signaling Technology; detections were presented in the supplementary (Table S1).
anti-ADRP (AP125) was from Progen; anti-SREBP-1 (39940) was from
Active Motif and HRP-conjugated goat anti-rabbit and goat anti-mouse 2.8. Western blot analysis
secondary antibodies were from Jackson Immuno Research. The
secondary antibodies conjugated to Alexa Fluor 488, 561, and 640, The cells were rinsed with PBS, lysed in lysis buffer (50 mM Tris
used for indirect immunofluorescence, were obtained from Invitrogen. [pH 7.5], 1 mM EGTA, 1 mM EDTA, 1% Triton X-100, 150 mM NaCl,
A chemical inhibitor of PLA2G4C, MAFP (M2939), and arachidonic acid 2 mM DTT, 100 mM PMSF, and 1 mg/ml proteinase inhibitor). After
(A3555) were purchased from Sigma. Oleate was purchased from vortexing for 30 min at 4 °C and centrifuging at 12,000g for 15 min at
Sinopharm Chemical Reagent Co., Ltd. 4 °C, the supernatants were collected and quantified using the Bradford
kit (Bio-Rad). The proteins were subjected to SDS-PAGE separation and
2.3. Plasmid construction and transfection western blot analysis as previously described [30].

The plasmid expressing EGFP fused to PLA2G4C, designated as 2.9. Indirect immunofluorescence and staining of LD and ER
pEGFP-PLA2G4C, was generated by inserting the coding sequence of
PLA2G4C into the BglII and PstI restriction sites of pEGFP-C1. Four Cells grown on coverslips were fixed with 3.7% paraformaldehyde
mutation sites (R54A, S82A, D385A and R402A) were introduced into for 15 min at room temperature, washed with phosphate-buffer saline
the pPLA2G4C by fusion PCR to generate the catalytically inactive (PBS), and permeabilized with 0.5% Triton X-100 in PBS for 10 min,
mutant pmPLA2G4C. The plasmid pPLA2G4CΔ260–292, with a deletion

693

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

then washed with PBS. After blocking with 1% normal goat serum 350 μl of deionized water and 250 μl of chloroform were added. The
(NGS) for 1 h at 37 °C, the cells were incubated overnight with the samples were then centrifuged and the lower organic phase containing
indicated primary antibodies diluted in 1% NGS, washed with PBS and lipids was extracted into a clean tube. Lipid extraction was carried out
subsequently incubated with secondary antibodies for 1 h at 37 °C. twice and the lipid extracts were pooled into a single tube and dried in
After washing, the cells were stained with Hoechst 33258 (Invitrogen) the SpeedVac under OH mode. Samples were stored at −80 °C until
for 10 min. The LDs and ER were stained with HCS LipidTOX™ red further analysis.
(Invitrogen, H34476) and ER-Tracker™ Red (Invitrogen, E34250),
respectively, for 30 min at 37 °C according to the manufacturer's 2.13.2. LC/MS
protocols. Images were taken using an UltraViewVox confocal micro- Polar lipids were analyzed using an Exion UPLC system coupled
scope (Perkin Elmer). For quantification of the LD in cells, the
automatic measurement program of the Volocity software (Perkin with a triple quadrupole/ion trap mass spectrometer (6500 Plus Qtrap;
Elmer) was used. A minimum of 30 cells was analyzed for each SCIEX) as described previously [32]. Separation of individual lipid
individual condition. classes of polar lipids by normal phase (NP)-HPLC was carried out using
a Phenomenex Luna 3 μ-silica column (internal diameter
2.10. Nile red staining and flow cytometry 150 × 2.0 mm) with the following conditions: mobile phase A (chlor-
oform:methanol:ammonium hydroxide, 89.5:10:0.5) and mobile phase
After the indicated treatment, cells were harvested, fixed with 3.7% B (chloroform:methanol:ammonium hydroxide:water, 55:39:0.5:5.5).
paraformaldehyde for 10 min and resuspended in 1 ml of PBS. One Individual lipid species was quantified by referencing to spiked internal
microliter stock solution of Nile red (Sigma, N3013) in acetone (1 mg/ standards. PC-14:0/14:0, PE-14:0/14:0, PS34:1-d31, PA-17:0/17:0, PG-
ml) was added to the cells. The samples were kept at least 45 min in the 14:0/14:0, Cer d18:1/17:0, SM d18:1/12:0, GluCer d18:1/8:0, GalCer
dark for equilibration with the dye. The analysis was carried out with d18:1/8:0, LacCer d18:1/8:0, Sph d17:1 were obtained from Avanti
the Accuri® C6 flow cytometer (BD). Polar Lipids. Dioctanoyl phosphatidylinositol (PI) (16:0-PI) was ob-
tained from Echelon Biosciences, Inc. Gb3-C17:0 was obtained from
2.11. Biochemical fractionation Matreya LCC and GM3 d18:1/17:0 was synthesized in-house. Neutral
lipids (TAGs, DAGs and CEs) were analyzed using a modified version of
Cells for each sample were collected and resuspended in PBS reverse phase HPLC/ESI/MS/MS described previously [33]. Briefly,
containing 0.25 M sucrose (PBS/sucrose) plus a protease inhibitor separation of lipids aforementioned was carried out on a Phenomenex
cocktail (Sigma). The cells were then lysed with 200 passages in a Kinetex 2.6 μ-C18 column (i.d. 4.6 × 100 mm) using an isocratic
tight fitting Dounce homogenizer on ice to ensure approximately 90% mobile phase chloroform:methanol:0.1 M ammonium acetate
lysis. The cell lysate was then centrifuged at 2500g for 10 min at 4 °C to (100:100:4) at a flow rate of 150 μl/min for 22 min. While TAG and
pellet cellular debris and nuclei. The resulting supernatant was referred DAG species were quantified using d5-TAG 48:0 and 4ME 16:0 Diether
to as the crude lysate containing both the cytoplasmic and membrane DG as an internal standards (Avanti Polar Lipids, Alabaster, AL, USA)
proteins. For protein solubilization studies, the crude lysate was respectively, CE species were quantified using d6-CE (CDN isotopes) as
incubated on ice for 1 h with or without one of the following internal standard.
compounds: 0.1 M Na2CO3, 1 M NaCl or 1% Triton X-100 for 1 h, then
centrifuged at 125,000g for 1 h with an SW55 rotor, after which the 2.14. Mice and lentivirus delivery
supernatant (S) and pellet fractions (P), resuspended in an equivalent
volume of 0.25 M sucrose (PBS/sucrose), were analyzed by western Male C57BL/6 mice (6 to 8 weeks of age) were maintained in
blot. specific pathogen-free conditions at the Central Animal Laboratory of
Wuhan Institute of Virology, Chinese Academy of Sciences (WIV, CAS)
2.12. Lipid droplet isolation and were handled following the guidance of animal ethical treatment.
All animal experiments were approved by the Institutional Animal
Lipid droplet was isolated as previously described [20]. Briefly, the Ethical Committee of WIV, CAS. The mice were fed with a high-fat diet
cells were washed with PBS, lysed in hypotonic buffer (50 mM HEPES, (HFD, 60 kcal% fat; Research Diets, New Brunswick, NJ) for 2 weeks,
1 mM EDTA and 2 mM MgCl2, pH 7.4) supplemented with protease then the indicated lentiviruses (109 pfu) were delivered by tail vein
inhibitors with 30 strokes in a tight fitting Dounce homogenizer on ice. injection. At seven days post-injection, blood samples were collected
After spinning 5 min at 1500 rpm, the supernatant, designated as post- from anesthetized animals, after which the mice were sacrificed. The
nuclear fractions, were mixed with equal volumes of 1.5 M sucrose in liver tissues were then collected, fixed in 4% paraformaldehyde and
isotonic buffer (50 mM HEPES, 100 mM KCl, and 2 mM MgCl2), placed embedded in optimal cutting temperature compound or paraffin, after
at the bottom of SW55 Ti (Beckman) centrifuge tubes, overlaid with which Oil Red O (ORO) or hematoxylin and eosin (H & E) staining was
isotonic buffer containing 1 mM PMSF and centrifuged for 2 h at performed. Expression of lenti-PLA2G4C-HA was detected by immuno-
100,000g. The top layer of the floating lipid droplet fraction was cut histochemical (IHC) staining with an anti-HA antibody (Cell Signaling
off (0.6 ml), and proteins of this fraction were precipitated by MCH. Technology, 3724S) as previously described [34].
Specifically, the lipid fraction was mixed with 2.4 ml of methyl alcohol,
0.6 ml of chloroform and 1.8 ml of ddH2O and then vortexed for 20 s. 2.15. Biochemical determinations
The mixture was incubated at 4 °C for 30 min and then centrifuged at
11,000 rpm for 15 min at 4 °C. The middle protein layer was resus- The serum alanine aminotransferase (ALT) level was measured with
pended in Laemmli buffer and subjected to western analysis. an ALT test kit (Shanghai Kehua Bio-engineering Co., Ltd). Total lipid
was extracted from approximately 50 mg of frozen liver as previously
2.13. Mass spectrometry-based lipidomics described [35]. The triacylglycerol (TG) and total cholesterol (TC)
levels in liver and plasma were measured using a TG Test kit and a TC
2.13.1. Lipid extraction test kit from Shanghai Kehua Bio-engineering Co., Ltd. Glucose levels in
Lipid was extracted from approximately 106 cells using a modified plasma were measured using a GLU test kit from Shanghai Kehua Bio-
engineering Co. The insulin concentrations in the plasma were deter-
version of the Bligh and Dyer's method as described previously [31]. mined by ELISA.
Briefly, cells were incubated in 750 μl of chloroform:methanol 1:2 (v/v)
with 10% deionized water for 30 min. At the end of the incubation,

694

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

2.16. Statistical analysis intracellular fraction) in Huh7.5.1-sh1120 cells compared with those in
the Huh7.5.1-shNC cells (Fig. 1C–E). The LD formation and the
Representative data from at least three independent experiments are localization of HCV Core in both cell lines were then analyzed by
shown. Statistical analyses were performed using unpaired two-tail HCS LipidTOX™ red and specific antibody staining. NS5A was indicated
Student's t-test when two sets were compared, one-way ANOVA by EGFP expression. Consistent with the previous report, Core and LDs
followed by Bonferroni's post hoc test for multiple comparisons. The accumulated perinuclearly in approximately 32% ± 4% of the HCV-
p-values were calculated and expressed as ** if p < 0.01, and * if infected Huh7.5.1-shNC cells [5]. However, this phenomenon was
p < 0.05. rarely observed in the Huh7.5.1-sh1120 cells (Fig. 1F). Most of the
HCV-infected Huh7.5.1-sh1120 cells showed no or few LDs scattered in
3. Results the cytoplasm (Fig. 1F). As a result, the average LD area in EGFP-
positive cells was significantly reduced in the Huh7.5.1-sh1120 cells
3.1. LD formation induced by HCV infection is impaired in the PLA2G4C (Fig. 1G). Although the reduced LD content could be due to the
knockdown cell line restricted HCV replication in the Huh7.5.1-sh1120 cells, it is also
probable that PLA2G4C was involved in the LD formation induced by
Previously, we have shown that PLA2G4C is involved in HCV- HCV infection, as the LD content in uninfected Huh7.5.1-sh1120 cells
induced membranous web formation, thus contributing to HCV RNA under normal incubation conditions (10%FBS) was lower than that in
replication. Evidence has also shown that PLA2G4C is required for HCV the control cells (Fig. 1H).
assembly through an unrevealed mechanism [27]. In further analysis,
stable Huh7.5.1 cell lines harboring shRNA targeting PLA2G4C or non- 3.2. PLA2G4C is required for LD formation
target shRNA were established and designated as Huh7.5.1-sh1120 and
Huh7.5.1-shNC, respectively. It was observed that the growth of the To figure out whether PLA2G4C is involved in LD formation,
Huh7.5.1-sh1120 cells was apparently slower than the Huh7.5.1-shNC Huh7.5.1-shNC and Huh7.5.1-sh1120 cells were starved for 24 h before
cells after 3 weeks of transduction, from which we supposed that stimulation with FBS or oleate. Both cell lines were devoid of LDs after
PLA2G4C is required to maintain the cell viability. Then the experi- starvation, whereas the FBS and oleate stimulation induced large
ment's window was chosen to be at 1–2 weeks post-lentiviral transduc- amounts of LD formation in Huh7.5.1-shNC cells but not in Huh7.5.1-
tion, when the PLA2G4C mRNA and protein levels were efficiently sh1120 cells (Fig. 2A and B), suggesting the requirement of PLA2G4C in
reduced without apparent cytotoxic effects (Fig. 1A–C). Consistent with FBS- or oleate-induced LD formation. For further confirmation, the LDs
the previous results [27], PLA2G4C knockdown significantly reduced were stained with Nile red and analyzed by flow cytometry. Compared
HCV replication and assembly as indicated by the 90% reduction in with serum-starved Huh7.5.1-shNC cells, the fluorescence profile
HCV RNA level, the weakened expression of HCV NS3 and Core shifted to the right after FBS and oleate stimulations, indicating the
proteins as well as the reduced viral assembly efficiency (calculated increase in LDs, whereas no obvious shifts were observed in Huh7.5.1-
as the ratio of HCV RNA copy numbers in the supernatant to that in the sh1120 cells treated with FBS or oleate (Fig. 2C). Similar to the

A B C D E

0.8 0.0020 ** 2.5 0.4

0.6cell proliferation 0.0015PLA2G4C/Actin Core HCV/Actin 2.0 0.3Assembly efficiency *
1.5
0.4 0.0010 NS3 1.0 0.2
PLA2G4C 0.5
0.2 0.0005 Actin 0.0 0.1
**
0.0 0.0000
0.0

shNC shNC shNC shNC
sh1120 sh1120 sh1120 sh1120

F nucleus NS5A LD Core Merge G H LD

shNC 8Percentage of LD area per cell shNC
6 shNC
sh1120 4 sh1120 **
2
0 sh1120

Fig. 1. LD formation induced by HCV infection is impaired in PLA2G4C knockdown cell line. (A) The cell viability of Huh7.5.1-shNC and –sh1120 cells was detected by WST-1. (B–G)
Huh7.5.1-shNC and -sh1120 cells were infected with J399EM at 0.1 moi for 72 h. The relative intracellular PLA2G4C mRNA levels (B) and HCV RNA levels (D) were examined by
quantitative RT-PCR. In all cases, relative levels of RNA are normalized to beta-actin RNA level and shown as mean ± SEM, and the experiments were performed in triplicate for three
times. Whole-cell lysates were subjected to western blot analysis for HCV NS3, Core, PLA2G4C and beta-actin (C). The assembly efficiency of HCV (E) was calculated. The NS5A
expression was indicated by EGFP, the Core expression was determined by indirect immunofluorescence, and LDs were stained with HCS LipidTOX™ Red (F). The percentage of LD area
per cell in EGFP-positive cells was calculated and shown as mean ± SEM (≥30 cells analyzed) (G). (H) The LDs were stained in Huh7.5.1-NC and -1120 cells cultured in normal
conditions (10% FBS). Scale bar, 15 μm. *p < 0.05, **p < 0.01.

695

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A shNC sh1120 B C

nucleus LD merge nucleus LD merge 8 shNC
6
oleate 10% FBS DMEM 4Percentage of LD area per cell sh NC DMEM
2 sh PLA2G4C FBS
0 oleate
**

**

10D%MEM Count
FBS
sh1120
oleate

D si NC si PLA2G4C E si NC
15 si PLA2G4C
nucleus LD merge nucleus LD merge Percentage of LD area per cell control
DMEM
oleate **

oleate DMEM 10

5

Nile Red

0

Huh7.5.1

F PLA2G4C LD merge magnify G

oleate 10% FBS DMEM control
15 PLA2G4C
Percentage of LD area per cell
10D%MEM **

** ** FBS
10 oleate
Percentage of LD area per cell
5 10D%MEM
FBS
oleate0

H nucleus EGFP-C1 HEK293T merge magnify I EGFP-C1
LDs merge nucleus PLA2G4C LDs PLA2G4C
8
oleate 10% FBS DMEM 6 **
4
2
0

Fig. 2. PLA2G4C is required for LD formation. (A–C) Huh7.5.1-shNC and -sh1120 cells were starved for 24 h and then stimulated by FBS or oleate for 12 h. The LDs in cells were stained
with HCS LipidTOX™ Red (A), and the percentage of LD area per cell was calculated (B). LDs were stained with Nile red and analyzed by flow cytometry (C). (D and E) Huh7.5.1 cells
transfected with siNC or siPLA2G4C were starved for 24 h and then stimulated by oleate for 12 h. LDs in cells were stained with HCS LipidTOX™ Red (D), and the percentage of LD area
per cell was calculated (E). (F and G) Huh7.5.1 cells were transfected with pEGFP-PLA2G4C and then cultured in DMEM with or without 10% FBS or stimulated with oleate for 12 h
before being harvested. PLA2G4C was indicated by EGFP, LDs in cells were stained with HCS LipidTOX™ Red (F), and the percentage of LD area per cell was calculated (G). (H and I)
HEK293T cells were transfected with pEGFP-C1 or pEGFP-PLA2G4C and then cultured in DMEM with or without 10% FBS or stimulated with oleate for 12 h. PLA2G4C was indicated by
EGFP, LDs in cells were stained with HCS LipidTOX™ Red (H), and the percentage of LD area per cell was calculated (I). The percentage of LD area per cell was reported as mean ± SEM
(≥30 cells analyzed), *p < 0.05, **p < 0.01. All experiments were repeated independently for three times. Scale bar, 15 μm.

response in stable shRNA cells, the silencing of PLA2G4C with siRNA It was observed that the over-expressed PLA2G4C formed ring-like
significantly reduced the LD formation in oleate-stimulated Huh7.5.1 structures around the LDs in Huh7.5.1 cells (Fig. 2F).
cells (siNC, 12 ± 4% vs siPLA2G4C, 0.8 ± 0.4%) (Fig. 2D and E).
Considering the high baseline of LD content in Huh7.5.1 cells under
In contrast, PLA2G4C overexpression in Huh7.5.1 cells enhanced normal incubation conditions, the overexpression experiments were
the FBS- or oleate-induced LD formation, as the LD area was increased performed in HEK293T cells, which contain very low levels of LD under
in the PLA2G4C-expressing cells compared with the non-PLA2G4C- normal incubation conditions [36] (Fig. 2H). Exogenous expression of
expressing cells under 10% FBS (6.43 ± 2.86% vs 1.31 ± 0.88%) and PLA2G4C did not increase the LD content when HEK293T cells were
oleate stimulation (9.51 ± 5.08% vs 2.04 ± 2.40%) (Fig. 2F and G). cultured under normal conditions (10%FBS) but did lead to a signifi-

696

X. Su et al. LD merge PLA2G4C ER merge BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A B

PLA2G4C DMEM oleate
Lysate LD Lysate LD
oleate DMEM
PLA2G4C
calnexin
ADRP

C nucleus PLA2G4C LD merge D PLA2G4C LD merge

0h a

a

b

3h

E LD b

8h PLA2G4C/LD

DMEM

12 h LD PLA2G4C/LD

24 h oleate

F nucleus PLA2G4C LD merge magnify

CHX-oleate oleate DMEM

Fig. 3. PLA2G4C relocalizes from the ER to LDs during LD Formation. (A and B) HEK293T cells were transfected with pEGFP-PLA2G4C and cultured with DMEM or oleate-containing
medium for 12 h. The expression of PLA2G4C was indicated by EGFP, and the LDs and ER were stained with HCS LipidTOX™ Red and ER-Tracker, respectively (A). Total cell lysate
(Lysate) and the LD fraction (LD) were isolated and subjected to western blot (B). (C) The distribution of EGFP-PLA2G4C and LD formation were observed at the indicated time points
after oleate stimulation. (D) The distribution patterns of PLA2G4C were indicated by white arrows (small particles not associated with lipids), green arrows (small particles associated
with lipids), red arrows (open ring-like structures surrounding lipids) and blue arrows (ring-like structures the lipids). (E) The three-dimensional structure of PLA2G4C and LDs were
reconstructed, and the red arrows indicated the LDs at one end of which were weakly covered by PLA2G4C. (F) HEK293T cells were transfected with pEGFP-PLA2G4C and then stimulated
with oleate in the presence or absence of CHX. The LDs were stained as described above. The localization of PLA2G4C is indicated by EGFP. All experiments were repeated independently
for three times. Scale bar, 15 μm.

cant increase in the total LD staining when the cells were stimulated 3.3. PLA2G4C translocates from the ER to LDs during LD formation
with oleate (Fig. 2H). Surprisingly, FBS and oleate only slightly induced
LD formation in vector transfected HEK293T cells (Fig. 2H and I). It is The different distribution patterns of PLA2G4C in HEK293T cells in
noteworthy that the over-expressed PLA2G4C showed a reticular the absence or presence of oleate (Fig. 2H) drove us to further analyze
distribution in the cytoplasm in non-stimulated cells as previously the relative localization of PLA2G4C with ER and LDs. Without oleate
reported [37,38] but formed a ring-like structure around the LDs in the stimulation, there was no LD structure in HEK293T cells and PLA2G4C
oleate-stimulated HEK293T cells (Fig. 2H). highly colocalized with an ER tracker; whereas in cells treated with
oleate, PLA2G4C accumulated around LDs and formed the ring-like
structures that still partially co-localized with the ER tracker (Fig. 3A).
Because LDs are often found in close proximity with the ER [39], we

697

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

performed cell fractionation analysis to determine whether PLA2G4C membrane association, a series of truncated mutants of PLA2G4C were
localized to the LDs surface or the associated ER membrane (Fig. 3B). constructed. The subcellular localization of these mutants was then
Calnexin, an ER marker, was detected only in the total cell lysate but analyzed by immunofluorescence and cell fractionation assay (Fig. S1).
not in the LD fraction, indicating the purity of the isolated LDs. ADRP, a Finally, we identified aa 260–292 of PLA2G4C was responsible for its
LD-associated protein, translocated to the LD fraction after oleate membrane association with ER and LDs. PLA2G4C with a deletion of aa
treatment as previously reported [40]; consistent with the observed 260–292 (designated as PLA2G4CΔ260–292) lost the ER-like distribution
fluorescence location, significant amounts of PLA2G4C were found in pattern and only partially co-localized with the ER in HEK293T cells
the LD fraction after oleate stimulation (Fig. 3B). Together, these results with or without LD induction and lost the function to induce LD
indicated that PLA2G4C translocated from ER to LDs after oleate formation during oleate stimulation (Fig. 4C). The absence of
stimulation. PLA2G4CΔ260–292 around LDs during oleate loading may be due to the
impaired LD formation. To assess the role of aa 260–292 of PLA2G4C in
The dynamic localization of PLA2G4C was further analyzed in its localization on LDs, the localization of PLA2G4CΔ260–292 was
HEK293T cells (Fig. 3C). EGFP-PLA2G4C distributed throughout the determined in Huh7.5.1 cells, which contain a high amount of LD
cytoplasm before oleate treatment, accumulated at distinct regions at under normal incubation conditions (Fig. 4D). Again, PLA2G4CΔ260–292
3 h post-oleate supplementation and clearly accumulated around the showed a cytoplasmic distribution pattern and no accumulation was
newly emerged LDs at 8 h post-oleate treatment, after which the LDs observed in Huh7.5.1 cells, indicating that aa 260–292 were respon-
surrounded by PLA2G4C grew bigger. Interestingly, we found that the sible for the localization of PLA2G4C on LDs. Additionally, LD isolation
localization of PLA2G4C could be divided into four patterns, including experiments showed that PLA2G4CΔ260–292could no longer translocate
small particles not associated with lipid, small particles associated with to the LD fraction after oleate stimulation (Fig. 4E). The aa 260–292 of
lipids, open ring like structures and ring like structures surrounding the PLA2G4C were then fused with EGFP, and the localization of the fusion
lipids (Fig. 3D). We further recorded optical sections through the EGFP- protein was analyzed in HEK293T and Huh7.5.1 cells. The results
PLA2G4C-expressing cells and reconstructed the three-dimensional shown in Fig. 4F showed that the fusion protein localized at the ER in
structure of LDs (Fig. 3E). PLA2G4C could cover the entire LDs surface, HEK293T cells and at LDs in Huh7.5.1 cells. These results indicated that
suggesting that PLA2G4C resides on the LDs surface after oleate the aa 260–292 were essential for ER and LDs membrane association
stimulation. It was notable that on one end of some LDs, there were and that the proper localization of PLA2G4C were required for the
less PLA2G4C which may represent the open ring like structures induction of LD formation.
observed in Fig. 3D. These results further supported that PLA2G4C
translocated from the ER to LDs during LD formation. 3.5. The enzymatic activity of PLA2G4C is required for its function in LD
formation
The localization of PLA2G4C to LDs could be due either to
relocalization of the existing pools of the protein or to the LDs Previously, we proposed that the enzymatic activity of PLA2G4C is
localization of newly synthesized PLA2G4C. To distinguish between required for its function in the membrane remodeling during HCV
these possibilities, PLA2G4C-expressing cells were treated with cyclo- infection [27]; meanwhile, the deletion of aa 1–100 of PLA2G4C, where
heximide (CHX) to block the synthesis of PLA2G4C and then stimulated the catalytic sites Arg54, Ser82 located, reduced its function in LD
with oleate to induce LD formation. The results showed that PLA2G4C formation (Fig. S1); thus, it is of interest to further reveal whether its
still efficiently targeted to LDs, indicating that new protein synthesis enzymatic activity was also crucial for LD formation. A mutant of
was not required for LDs targeting and that the localization of PLA2G4C PLA2G4C (designated as mPLA2G4C), which has lost its catalytic
around LDs was due to relocalization (Fig. 3F). activity, was generated by mutating the conserved residues in PLA2G4C
(Arg-54, Ser-82, Asp-385, Arg-402) to alanine as previously reported
3.4. Membrane association and topology of PLA2G4C [45]. Significantly less LD formation was observed in mPLA2G4C-
expressing HEK293T cells compared with cells expressing wild type
PLA2G4C has been shown to be a membrane-associated protein PLA2G4C after being induced with oleate (Fig. 5A and B). Interestingly,
[41], but it is not clear by which manner it attaches to the membrane. mPLA2G4C accumulated at distinct areas in the cytoplasm and formed
Revealing the topology of PLA2G4C on the membrane will help to a ring-like structure; however, most of these ring-like structures did not
understand how it participates in LD formation. First, we assessed surround the lipid content as PLA2G4C had (Fig. 5A). To further
whether PLA2G4C was an integral membrane protein by membrane investigate the enzymatic activity of PLA2G4C in LD formation, MAFP,
extraction experiments in which high salt (1 M NaCl) or high pH (0.1 M a chemical inhibitor of PLA2G4C, was supplemented to the cell culture
Na2CO3 buffer [pH 11.5]) treatments could release peripheral mem- of Huh7.5.1 cells, and the LD content was observed. The results shown
brane proteins. Although HCV NS5A behaves as an integral protein in Fig. 5C and D showed that treatment of cells with MAFP markedly
tethered to the membrane by amphipathic α-helices, high salt and high reduced LD content in Huh7.5.1 cells. The LD content in HCV-infected
pH treatments can release a small fraction of NS5A [42]. The HCV NS2 cells was also significantly reduced by MAFP treatment (Fig. 5E and F),
protein is a multiple transmembrane protein and is highly resistant to which was consistent with our previous results that MAFP treatment
high salt and high pH treatments [43]. These two proteins were used as impairs HCV assembly [27]. To determine whether the free fatty acids
controls. As shown in Fig. 4A, when expressed in HEK293T cells with or released by PLA2G4C contributes to the LD accumulation, the function
without oleate stimulation, only a small fraction of PLA2G4C could be of arachidonic acid in LD formation induced by FBS and oleate was
solubilized under high pH and high salt conditions, while a large detected in the Huh7.5.1-sh1120 cells. It's interesting that though
fraction of PLA2G4C was released by Triton X-100 treatment, indicating couldn't induce LD formation alone, the present of arachidonic acid
that PLA2G4C was tightly associated with membranes and behaved as partially rescued the formation of LD induced by FBS and oleate in
an integral membrane protein. Further, by proteinase K digestion Huh7.5.1-sh1120 cells (Fig. 5G and H). Together, these results indi-
analysis, we assessed whether the N and C terminus of PLA2G4C were cated that enzymatic activity of PLA2G4C was indispensable for its
localized in the cytoplasm or the ER lumen. In this experimental set, the function in LD formation.
HA tag, fused to the N termini of NS2, which was localized in the ER
lumen, could be protected from proteinase K digestion [44] (Fig. 4B), 3.6. PLA2G4C causes a global increase in the cellular lipid content without
whereas HA tags fused to the C termini of NS2 and either terminus of appreciable changes in lipid compositional profiles
PLA2G4C or NS5A were readily digested by Proteinase K, indicating
that the N and the C termini of PLA2G4C were localized to the cytosol SREBP-1c is an important regulator of lipogenic gene expression.
(Fig. 4B).

To identify the functional domains of PLA2G4C that are required for

698

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A PS B N-HA C-HA
Merge TX-100 - - + - -+
S PS P S P Fraction - ++
PLA2G4C(oleate) PK - + +
PLA2G4C(DMEM)
NS5A PLA2G4C
NS2
HEK293T NS5A

PLA2G4C ER NS2

C DMEM oleate
ER
PLA2G4C Merge nucleus PLA2G4C LD Merge

PLA2G4C

PLA2G4C
260-292

D Huh 7.5.1 merge E

nucleus PLA2G4C LD control oleate
Lysate LD Lysate LD
PLA2G4C
PLA2G4CΔ260-292
PLA2G4C
260-292 Calnexin

ADRP

F nucleus EGFP- LD merge nucleus EGFP- ER merge
260-292
260-292

Huh7.5.1 HEK293T

Fig. 4. Membrane association and topology of PLA2G4C. (A) HEK293T cells were transfected with pPLA2G4C, pNS5A or pNS2. The crude lysates were obtained according to the

procedure described in materials and methods. Crude lysates were incubated with various chemical reagents and centrifuged to separate soluble (S) and pellet (P) fractions. The fractions
were analyzed by western blot. (B) The crude lysates of HEK293T cells transfected with the plasmids expressing PLA2G4C, NS2 or NS5A fused with HA tag at the N or C terminus
respectively were digested by Proteinase K (PK) in the presence or absence of 1% Triton X-100 (TX-100) for 20 min on ice; then the digestion was blocked by PMSF at a concentration of
2 mM, followed by western blot analysis. (C) HEK293T cells were transfected with pEGFP-PLA2G4C or pEGFP-PLA2G4C△260–292 and cultured in DMEM in the absence or presence of
oleate stimulation. The expression of PLA2G4C was indicated by EGFP, and the LDs, ER and nuclei were stained with LipidTOX™ Red, ER tracker, and Hoechst 33258, respectively. (D)
Huh7.5.1 cells were transfected with pEGFP-PLA2G4C and pEGFP-PLA2G4C△260–292. The LDs and nuclei were stained as described above. (E) Huh7.5.1 cells were transfected with EGFP-
PLA2G4C△260–292 and stimulated with or without oleate stimulation. LD fraction was isolated. Total cell lysate (Lysate) and the LD fraction (LD) were subjected to western blot analysis.

(F) HEK293T cells and Huh7.5.1 cells were transfected with pEGFP-260-292. The LDs, ER and nuclei were stained as described above. All experiments were repeated independently for
three times. Scale bar, 15 μm.

The influence of PLA2G4C on the activation of SREBP-1c under in the levels of both the neutral lipids and polar lipids (Fig. 6C); but the
different stimulus was investigated. Interestingly, both the precursor overall lipid composition was not changed significantly as the changes
and matured forms of SREBP-1c were reduced in PLA2G4C knockdown in individual lipid species were comparable across the three groups, as
cell line, either untreated or treated with FBS, oleate and HCV (Fig. 6A). shown in Fig. 6D a representative example of the distribution of
On the other hand, the overexpression of PLA2G4C increased the individual PA species. Thus the changes in lipid content caused by
precursor and matured forms of SREBP-1c in Huh7.5.1 cells (Fig. 6B). PLA2G4C are somewhat universal and not confined to specific lipids.
Thus PLA2G4C may enhance the lipogenesis via modulating the SREBP-
1c expression and activation. 3.7. The participation of PLA2G4C in LD formation is correlated with its
involvement in HCV assembly
To understand how PLA2G4C alters the intracellular lipid composi-
tion, we compared the lipidomic profiles of PLA2G4C, mPLA2G4C and Our previous results showed the up-regulation of PLA2G4C by HCV
control vector overexpressed Huh7.5.1 cells. In total, 363 individual infection, and that PLA2G4C is involved in HCV virion assembly [27].
lipid species from 19 classes were analyzed (Table S2). Generally, the We then analyzed whether the function of PLA2G4C in LD formation is
overexpression of PLA2G4C but not mPLA2G4C led to a global increase

699

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A HEK293T B C Huh7.5.1 D

nucleus PLA2G4C LD merge ** ** nucleus LD Merge
mPPELLGAAF22PGG-44CCC1 Percentage of LD area per cell15 Percentage of LD area per cell8
mPLA2G4CPLA2G4C EGFP-C1 MAFP mock mock
10 MAFP6

4

5

2 *

0 0

E nucleus NS5A LD Core Merge F Percentage of LD area per cell15
mock10
MAFP mock MAFP
5

**

0

G DMEM 10% FBS oleate H

nucleus LDs merge nucleus LDs merge nucleus LDs merge shNC
sh1120
shNC Percentage of LD area per cell5sh1120+AA **
DMEM **
10%FBS4**
oleate** **
sh1120 3
**

2

sh1120 1
AA
0

Fig. 5. The enzymatic activity of PLA2G4C is required for its function in the LD formation. (A and B) HEK293T cells were transfected with pEGFP-C1, pEGFP-PLA2G4C, or pEGFP-
mPLA2G4C and then stimulated with oleate for 12 h. The expression of PLA2G4C was indicated by EGFP, and the LDs and nuclei in the cells were stained with LipidTOX™ Red and
Hoechst 33258, respectively (A). The percentage of LD area per cell was calculated (B). (C and D) Huh7.5.1 cells were starved from serum for 24 h and then stimulated with 10% FBS
culture medium mixed with or without (mock) MAFP at a concentration of 250 μM for 12 h. LDs and nuclei in the cells were stained as described above (C). The percentage of LD area per
cell was calculated (D). (E and F) Huh7.5.1 cells were infected with J399EM at 0.1 moi for 6 h before being incubated with or without MAFP at a concentration of 250 μM, and then the
cells were fixed at 72 h post-infection (hpi). The expression of NS5A was indicated by EGFP, and Core was determined by indirect immunofluorescence; the LDs and nuclei in the cells
were stained as described above (E). The percentage of LD area per cell was calculated (F). (G and H) Huh7.5.1-shNC or –sh1120 cells were stimulated with indicated stimulus for 12 h in
the absence or presence of 50 μM arachidonic acid (AA). The LDs and nuclei in the cells were stained (G) and the percentage of LD area of per cell was calculated (H). The percentage of
LD area per cell was reported as mean ± SEM (≥ 30 cells analyzed), *p < 0.05, **p < 0.01. All experiments were repeated independently for three times. Scale bar, 15 μm.

correlated with its function in HCV assembly. 3.8. PLA2G4C mediates LD accumulation in the liver of HFD-fed mice

LD content and HCV propagation were monitored in sh1120 cells To determine whether the expression of PLA2G4C protein leads to
LD accumulation in vivo, control and PLA2G4C-expressing lentiviruses
transduced with lentivirus expressing shRNA-resistant PLA2G4C, were injected into HFD-fed male mice via the tail vein. The expression
PLA2G4C△260–292, and mPLA2G4C. The corresponding constructs were of PLA2G4C in liver tissue was confirmed by IHC (Fig. 8A). The body
expressed efficiently in sh1120 cells as indicated by indirect immuno- weight and alanine aminotransferase (ALT) level in the serum was not
fluorescence (Fig. S2). PLA2G4C expression significantly increased LD changed (Fig. 8C and D), indicating that the expression of PLA2G4C in
staining in sh1120 cells, whereas PLA2G4C△260–292 or mPLA2G4C liver did not influence the liver function. Increased lipid deposits in
Lenti-PLA2G4C mice were observed by ORO staining (Fig. 8A), and the
failed to increase the staining (Fig. S2). The LD formation and Core percentage of hepatocytes with obvious lipid droplets among the total
hepatocytes was increased from 0.35% in control mice to 1.18% in
accumulation around LDs during HCV infection were restored in Lenti-PLA2G4C mice (Fig. 8B). H & E staining also showed increased
PLA2G4C-rescued sh1120 cells but not in PLA2G4C△260–292 or vacuolation in the liver of Lenti-PLA2G4C mice (Fig. 8A). Consistently,
the triglyceride (TG) and total cholesterol (TC) levels in the liver and
mPLA2G4C-overexpressing cells (Fig. 7A and B). Consistently, the serum were elevated moderately in Lenti-PLA2G4C mice, though the
difference between groups was not statistically significant (Fig. 8E–H).
typical colocalization of Core and NS5A around LDs was observed in An increase of the glucose but not insulin level in serum was observed
(Fig. 8I and J). The mRNA level of Srebp-1c and several lipogenic genes
only PLA2G4C-rescued sh1120 cells (Fig. 7A). The expression of HCV in the liver tissue were also examined, and results showed that the

proteins, especially Core protein, was restored by the overexpression of
PLA2G4C but not by PLA2G4C△260–292 or mPLA2G4C in sh1120 cells
(Fig. 7C). The inhibitory effect of PLA2G4C knockdown on HCV
assembly efficiency was also overcome by ectopic expression of
PLA2G4C but not PLA2G4C△260–292 or mPLA2G4C (Fig. 7B). These

results implied that the function of PLA2G4C in HCV virion assembly

correlated with its function in LD formation.

700

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A B

DMEM 10% FBS oleate HCV DMEM 10%FBS oleate HCV
shNC
sh1120
shNC
sh1120
shNC
sh1120
shNC
sh1120
NC
PLA2G4C
NC
PLA2G4C
NC
PLA2G4C
NC
PLA2G4C

SREBP-1c (Precursor) SREBP-1c (Precursor)
SREBP-1c (Mature) SREBP-1c (Mature)
Actin Actin
NS3 PLA2G4C

C NS3

D control

mPLA2G4C

0.05 PLA2G4C *
0.04 * *
0.03 * *
0.02 *
µmoles lipids 0.01 ** *
* * *
CE ** *
Cho *
DAG
TAG0.0006 *
PC0.0004 **
PE00..00000020 **

PI
PA
PS
PG
SM

0.0001 control *
*
0.0000 mPLA2G4C
moles lipids PLA2G4C
*
* ** * * * *
* * *
0.0000 * * * *
* *
* * *
*
*

PPPPPPPPPPAAAAAAAAAA33333333332848624628::::::::::2521032411

Fig. 6. PLA2G4C causes a global increase in the overall cellular lipid content. (A) Huh7.5.1-shNC and -sh1120 cells were stimulated with FBS or oleate for 12 h or infected with HCV at
0.1 moi for 72 h. The indicated protein expression was detected by western blot with specific antibodies. (B) Huh7.5.1 cells were transduced with control lentivirus or lentivirus express
PLA2G4C, then the cells were treated and detected as described in panel A. (C and D) Huh7.5.1 cells were transduced with control lentivirus or lentivirus express PLA2G4C or mPLA2G4C.
Total lipids were extracted and subjected for lipidomic analysis as described in material and methods. The amount of selected neutral lipids and polar lipids (C) and representative
example of individual PA species (D) were shown and reported as mean ± SEM, *p < 0.05. Abbreviations: CE, cholesteryl esters; Cho, cholesterols; DAG, diacylglycerols; TAG,
triacylglycerols; PC, phosphatidylcholines; PE, phosphatidylethanolamines; PI, phosphatidylinositols; PA, phosphatidic acids; PS, phosphatidylserines; PG, phosphatidylglycerols; SM,
sphingomyelins. The experiments in panels A and B were repeated three times. The lipidomic analysis was performed once in quadruplicate.

mRNA levels of Srebp-1c, Acc1, Fasn, and Scd1 were elevated in Lenti- we identified PLA2G4C as a new factor functioning in LD formation.
PLA2G4C mice (Fig. 8K). Thus it's possible that overexpression of Evidences have shown that PLA2G4C is required for LD formation that
PLA2G4C in the liver enhanced the de novo lipogenesis. Notice that is stimulated by fatty acid and HCV, during which the membrane
PLA2G4C expression in mice fed with regular chow didn't influence the association and the enzymatic activity of PLA2G4C, are necessary.
lipid content in liver and serum (Fig. S3) and that the amount of hepatic PLA2G4C translocated from the ER to the LDs surface during LD
fat accumulation and the elevation of hepatic fat by PLA2G4C over- formation. The facts that the participation of PLA2G4C in LD formation
expression were very mild, this was probably because the duration of correlated with its involvement in HCV assembly and that PLA2G4C
HFD (2 weeks) was too short. Together, these data showed that overexpression could enhance the lipid accumulation in the liver of
PLA2G4C was involved in LD formation in HFD mice. mice indicated PLA2G4C as a host factor for HCV replication and
pathogenesis.
4. Discussion
Phospholipase A2 (PLA2s), a family of enzymes that hydrolyze the
As multifunctional organelles, cytosolic LDs also serve as HCV fatty acid at the sn-2 position of phospholipids, play pivotal roles in cell
assembly initiation sites, but the mechanism by which HCV promotes signaling and inflammation [46]. Recently, it has been reported that
LD formation and accumulation remains largely unclear. In this study, these enzymes also function as key regulators of lipid droplet home-
ostasis [47]. Although various cellular PLA2s may contribute to

701

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A NS5A LD Core Merge B C

shNC 20 Percentage of LD area per cell shNC sh1120
vector 15 Assembly efficiency
10 ** ** **** NS3
vector Core
5 * PLA2G4C
** * Actin
0.25 *
0.20
sh1120 0.15
mPLA2G4C PLA2G4C PLA2G4C 0.10
0.05
260-292 0.00

vector
vector
PLA2G4C
PLA2G4C260-292
mPLA2G4C
vector
vector
PLA2G4C
PLA2G4C260-292
mPLA2G4C

shNC sh1120 shNC sh1120

Fig. 7. The participation of PLA2G4C in LD formation is correlated with its involvement in HCV assembly. Huh7.5.1-shNC or –sh1120 cells were transduced with lentiviruses expressing
shRNA-resistant PLA2G4C, PLA2G4C Δ 260–292, or mPLA2G4C and then infected with J399EM at an 0.1 moi for 72 h. (A) Cells were collected and fixed, Core (purple) was determined by
indirect immunofluorescence, NS5A (green) was indicated by EGFP and LDs (red) were stained with LipidTOX™ Red. (B) The percentage of LD area per cell (≥ 30 cells analyzed) and HCV
assembly efficiency were calculated and reported as mean ± SEM, *p < 0.05, **p < 0.01. (C) The expression of NS3, Core, PLA2G4C and beta-actin were analyzed by western blot.
The experiments were repeated independently for three times. Scale bar, 15 μm.

generating free fatty acids from membrane phospholipids initially and the open ring-like structure may present the pre-nascent LDs which
needed for LD synthesis, strong evidence supports that the PLA2 form, are not disassociated from ER. Because both the proper localization and
such as PLA2G4A, is also involved in the remodeling of ER phospho- the enzymatic activity of PLA2G4C were required for its function in LD
lipids and the LD expansion processes [48,49]. Here, we found that biogenesis, we supposed that PLA2G4C plays a role in the initial steps of
PLA2G4C, closely related to PLA2G4A, is also involved in LD biogen- LD formation, such as neutral lipid accumulation or LD structure
esis. Though PLA2G4C and PLA2G4A have a similar function in generation.
regulating LD formation, the overexpression of PLA2G4A in the
PLA2G4C knockdown cell line could not rescue the LD formation PLA2G4C is a membrane-bound protein and has been found in
(Fig. S4). This suggests that the functions of PLA2G4C and PLA2G4A various membrane fractions, including ER, mitochondria, Golgi, LD and
are irreplaceable and that the functions of these two phospholipase are nuclear membranes [37,38,51]. In the present study, we found that
not redundant. PLA2G4C translocated from the ER to LDs during LD formation, which
is consistent with the process of LD formation. PLA2G4A has been
Consistent with previous report that overexpression of PLA2G4C reported to translocate to LDs after activation and associate with
increased the TG level in Huh7 cells [50], the overexpression of membrane through its CaLB domain [52,53]. The way in which
PLA2G4C in HFD-mice also results in the increase of the TG and TC PLA2G4C binds to the membrane is not clear. PLA2G4C is the only
level (Fig. 6). The lipidomic analysis showed that PLA2G4C over- exception in the Group IV PLA2 family, as it does not contain a C2
expression caused a global increase of lipid content without significant domain that promotes the interaction of protein with membrane [54].
change in the lipid composition. This could be explained by the The lipid modification of PLA2G4C at the CAAX motif at C terminus
enhanced SREBP-1c expression and activation by PLA2G4C. Further was found to facilitate its membrane association [55]. However,
studies are required to explore how PLA2G4C modified SREBP-1c PLA2G4C with the mutation disrupting the CAAX motif remained in
expression and activation. Besides, the released free fatty such as acid the membrane fraction and localized at the ER [38,41,56], indicating
arachidonic acid may serve as secondary mediators to activate intra- that there is another component responsible for the association of
cellular signaling. In our results, the addition of arachidonic acid could PLA2G4C with the membrane. Consistent with this hypothesis, we
rescue FBS and oleate stimulated LD formation in PLA2G4C knockdown identified aa 260–292 in the middle of PLA2G4C that are required for
cell line, indicating that rather than serves as free fatty acid incorpo- its membrane binding both at the ER and the LDs. The N and C termini
rated into triacylglycerol, the secondary mediator released by of PLA2G4C are localized to the cytosol side of membrane; thus, it
PLA2G4C, arachidonic acid may activate the intracellular signaling should have even numbers of transmembrane domain, if any. Sequence
and promote the LD formation induced by FBS and oleate. This is analysis of PLA2G4C by HMMTOP [57] predicted a transmembrane
consistent with previous report that arachidonic acid promote PLA2- helix near the N terminus (amino acids 44–63), but no transmembrane
G4A-dependent LD accumulation by activating p38 and JNK [51]. domain was predicted by TMHMM [58]. Our results also showed that
PLA2G4C is tightly associated with membrane and behaves as an
In addition to PLA2 activity, PLA2G4C has lysophospholipase integral membrane protein (Fig. 5A). The structure of PLA2G4C needs
activity and transacylation activity with substrate specificity for LPC to be resolved for further understanding of the detailed membrane
and LPE [38]. Thus, PLA2G4C may also control the local composition of association and the translocation mechanisms of this protein.
phospholipids such as PC/LPC and PE/LPE, which changes the local
membrane curvature and is required for the LD structure formation. In After stimulation of the cells with a variety of agonists, PLA2G4A is
our research, four phases of PLA2G4C distribution were observed activated by phosphorylation at Ser505 by different members of the
during LD formation (Fig. 3C and D), wherein a cluster of PLA2G4C mitogen-associated protein kinase (MAPK) family of enzymes, which is
in a specific region was formed before obvious lipid deposition, the necessary for LD formation [51]. PLA2G4A is also maintained in an
association of PLA2G4C with lipid content was observed thereafter, and inactive state in HEK293T cells. The enzymatic activity of PLA2G4C in
open ring-like or ring-like structure of PLA2G4C surrounding lipid HEK293T cells could be induced by hydroperoxides or FBS [37,45].
content was formed at late time post-oleate stimulation. It is likely that Here, we found that the overexpression of PLA2G4C alone did not
the clustering site of PLA2G4C is where the neutral lipid accumulates, induce LD formation in HEK293T cells, whereas oleate induction was

702

X. Su et al. B BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

A 2.5 p=0.0505 CD

lenti-NC lenti-PLA2G4C 2.0
1.5
ORO H&E IHC The percentage of Oil-red O 1.0 38 ALT (U/L) 25
staining area 0.5 lenti-NC 20
0.0 15
lenti-P lLeAn2ti-G4NCC 36 lenti-PLA2G4C 10
body weight
34 5
0
32
lenti-P lLeAn2ti-G4NCC
30

28
12345678

E TG levels (mg/g liver tissue) F TC levels (mg/g liver tissue) G * H
lenti-P lLeAn2ti-GN4CC lenti-P lLeAn2ti-G4NCC
35 p=0.0526 20 p=0.0795 100 serum TG (mg/dl) 250 p=0.1070serum TC (mg/dl)
80
30 15 60 200
25 10 40 150
20 20 100
15 5 0
0 50
0

lenti-P lLeAn2ti-GN4CC lenti-P lLeAn2ti-G4NCC

I ** J K relative RNA level/16S lenti-NC **
lenti-PLA2G4C
200 Plasma Glucose 4000 Plasma Insulin 10
150 (mg/dl) 3000 (pg/ml) 8 ***
100 2000 6
50 1000 4
2
0 0 0

lenti-P lLeAn2ti-GN4CC lenti-P lLeAn2ti-GN4CC Srebp-1c Acc1 Fasn Scd1

Fig. 8. PLA2G4C mediates LD accumulation in the liver of HFD-fed mice. Control and PLA2G4C-expressing lentiviruses were injected to HFD-fed mice via the tail vein. Seven days after
injection, the mice were sacrificed for analysis. (A) Immunohistochemistry (IHC) of the liver sections showed the expression of PLA2G4C (top); H & E staining (middle) and ORO staining
(bottom) of liver sections showed the increase structure of LDs. (B) The percentage of ORO-staining areas of each section was calculated using the Pannoramic Viewer software. (C) The
body weight was determined every day after lentivirus injection. (D) The ALT levels in the plasma were determined. (E–H) Levels of triglyceride (TC) and total cholesterol (TG) in the liver
and plasma were determined as described in the materials and methods. (I and J) The glucose and circulating insulin levels were detected. (K) The mRNA levels of Srebp-1c and several
lipogenic genes in the liver tissue were examined. All the data were presented as the means ± SEM (n = 5). The experiments were repeated three times. *p < 0.05, **p < 0.01.

essential for LD formation. However, the detailed mechanism of HEK293T cells [45]. It is interesting that overexpression of PLA2G4C
PLA2G4C activation is unclear, although it has been reported that alone in Huh7.5.1 cells could induce LD formation, which was further
H2O2 might active the enzymatic activity of PLA2G4C though a tyrosine enhanced by the addition of oleate and FBS. This means that PLA2G4C
phosphorylation pathway [37]. There are several potential PKC phos- is constitutively activated in hepatocytes, which might be one reason
phorylation sites in PLA2G4C, and recent proteomic analysis suggested for the high baseline LD content in Huh7.5.1 cells under normal
a phosphorylation site at aa 337 of PLA2G4C [37,59]. Whether incubation conditions.
PLA2G4C activation undergoes phosphorylation under particular con-
ditions remains to be explored. It is also proposed that the endogenous Liver steatosis (fatty liver), which is the accumulation of hepato-
suppressors maintain the activity, as PLA2G4C is very actively releasing cellular lipid droplets that are the storage sites of cytosolic neutral
fatty acids from the isolated cell membranes but not in the intact lipids, is a common pathology in HCV-infected patients. HCV modulates
lipid homeostasis by increasing lipogenesis via SREBP-1 activation [22]

703

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

and reducing oxidation and lipid export [60]. Here, we found that [12] R.V. Farese Jr., T.C. Walther, Lipid droplets finally get a little R-E-S-P-E-C-T, Cell
PLA2G4C, which is up-regulated by HCV infection, is required for HCV- 139 (2009) 855–860.
induced LD accumulation in hepatocytes. PLA2G4C enhanced SREBP-
1c expression and activation in HCV infected Huh7.5.1 (Fig. 6). When [13] A. Pol, S.P. Gross, R.G. Parton, Review: biogenesis of the multifunctional lipid
overexpressed in vivo, PLA2G4C increased the mRNA levels of Srebp-1c droplet: lipids, proteins, and sites, J. Cell Biol. 204 (2014) 635–646.
and some lipogenic genes such as Acc1, Fasn and Scd1, and stimulated
the HFD-induced lipid deposition in the liver. Thus, PLA2G4C is [14] P.E. Bickel, J.T. Tansey, M.A. Welte, PAT proteins, an ancient family of lipid droplet
probably an important host factor in liver steatosis and HCV pathogen- proteins that regulate cellular lipid stores, Biochim. Biophys. Acta 1791 (2009)
esis. The knockdown of PLA2G4C expression could reduce both HCV 419–440.
replication and the LD formation in HCV-infected cells, implying that
PLA2G4C could be a target for an anti-HCV drug. [15] D.L. Brasaemle, Thematic review series: adipocyte biology. The perilipin family of
structural lipid droplet proteins: stabilization of lipid droplets and control of
Supplementary data to this article can be found online at http://dx. lipolysis, J. Lipid Res. 48 (2007) 2547–2559.
doi.org/10.1016/j.bbalip.2017.03.007.
[16] J. Gong, Z. Sun, P. Li, CIDE proteins and metabolic disorders, Curr. Opin. Lipidol. 20
Authors' contributions (2009) 121–126.

XC and RP conceived and designed the study. XS, SL, XZ, XH and YZ [17] P.T. Bozza, I. Bakker-Abreu, R.A. Navarro-Xavier, C. Bandeira-Melo, Lipid body
conducted the experiments. RP, YW, JC, CW, ML and XC analyzed the function in eicosanoid synthesis: an update, Prostaglandins Leukot. Essent. Fat.
data. XS, RP and XC wrote the manuscript. SML and GS contributed to Acids 85 (2011) 205–213.
lipidomic analysis.
[18] D.L. Diamond, A.J. Syder, J.M. Jacobs, C.M. Sorensen, K.A. Walters, S.C. Proll,
Conflict of interest statement J.E. McDermott, M.A. Gritsenko, Q. Zhang, R. Zhao, T.O. Metz, D.G. Camp 2nd,
K.M. Waters, R.D. Smith, C.M. Rice, M.G. Katze, Temporal proteome and lipidome
The authors declare that they have no conflicts of interest with the profiles reveal hepatitis C virus-associated reprogramming of hepatocellular
contents of this article. metabolism and bioenergetics, PLoS Pathog. 6 (2010) e1000719.

Transparency document [19] G. Camus, E. Herker, A.A. Modi, J.T. Haas, H.R. Ramage, R.V. Farese, M. Ott,
Diacylglycerol acyltransferase-1 localizes hepatitis C virus NS5A protein to lipid
The http://dx.doi.org/10.1016/j.bbalip.2017.03.007 associated droplets and enhances NS5A interaction with the viral capsid core, J. Biol. Chem.
with this article can be found, in online version. 288 (2013) 9915–9923.

Acknowledgments [20] D.A. Vogt, G. Camus, E. Herker, B.R. Webster, C.L. Tsou, W.C. Greene, T.S.B. Yen,
M. Ott, Lipid droplet-binding protein TIP47 regulates hepatitis C virus RNA
We are grateful to Dr. Ding Gao and Ms. Anna Du for technical replication through interaction with the viral NS5A protein, PLoS Pathog. 9 (2013).
support in confocal microscopy. This work was supported by the
National Basic Research Priorities Program of China (2013CB911100, [21] S. Salloum, H.L. Wang, C. Ferguson, R.G. Parton, A.W. Tai, Rab18 binds to hepatitis
2015CB554304) and the National Natural Science Foundation of China C virus NS5A and promotes interaction between sites of viral replication and lipid
(81672021, 81461130019, 31321001). droplets, PLoS Pathog. 9 (2013).

References [22] Q.S. Li, V. Pene, S. Krishnamurthy, H. Cha, T.J. Liang, Hepatitis C virus infection
activates an innate pathway involving IKK-alpha in lipogenesis and viral assembly,
[1] T. Fujimoto, R.G. Parton, Not just fat: the structure and function of the lipid droplet, Nat. Med. 19 (2013) 722 (−+).
Cold Spring Harb. Perspect. Biol. 3 (2011).
[23] C. Harris, E. Herker, R.V. Farese, M. Ott, Hepatitis C virus core protein decreases
[2] J.K. Zehmer, Y. Huang, G. Peng, J. Pu, R.G. Anderson, P. Liu, A role for lipid lipid droplet turnover a mechanism for core-induced steatosis, J. Biol. Chem. 286
droplets in inter-membrane lipid traffic, Proteomics 9 (2009) 914–921. (2011) 42615–42625.

[3] J.M. Goodman, The gregarious lipid droplet, J. Biol. Chem. 283 (2008) [24] K. Moriya, H. Yotsuyanagi, Y. Shintani, H. Fujie, K. Ishibashi, Y. Matsuura,
28005–28009. T. Miyamura, K. Koike, Hepatitis C virus core protein induces hepatic steatosis in
transgenic mice, J. Gen. Virol. 78 (1997) 1527–1531.
[4] R. Bartz, J.K. Zehmer, P.S. Liu, The new face of lipid droplets, Prog. Biochem.
Biophys. 32 (2005) 387–392. [25] W. Su, Y. Wang, X. Jia, W.H. Wu, L.H. Li, X.D. Tian, S. Li, C.J. Wang, H.M. Xu,
J.Q. Cao, Q.F. Han, S.M. Xu, Y. Chen, Y.F. Zhong, X.Y. Zhang, P.S. Liu,
[5] Y. Miyanari, K. Atsuzawa, N. Usuda, K. Watashi, T. Hishiki, M. Zayas, J.A. Gustafsson, Y.F. Guan, Comparative proteomic study reveals 17 beta-HSD13 as
R. Bartenschlager, T. Wakita, M. Hijikata, K. Shimotohno, The lipid droplet is an a pathogenic protein in nonalcoholic fatty liver disease, Proc. Natl. Acad. Sci. U. S.
important organelle for hepatitus C virus production (vol 9, pg 1089, 2007), Nat. A. 111 (2014) 11437–11442.
Cell Biol. 9 (2007) 1216.
[26] L. Xu, L.K. Zhou, P. Li, CIDE proteins and lipid metabolism, Arterioscler. Thromb.
[6] F.A. Carvalho, F.A. Carneiro, I.C. Martins, I. Assuncao-Miranda, A.F. Faustino, Vasc. Biol. 32 (2012) 1094–1098.
R.M. Pereira, P.T. Bozza, M.A. Castanho, R. Mohana-Borges, A.T. Da Poian,
N.C. Santos, Dengue virus capsid protein binding to hepatic lipid droplets (LD) is [27] S. Xu, R.J. Pei, M. Guo, Q.X. Han, J. Lai, Y. Wang, C.C. Wu, Y. Zhou, M.J. Lu,
potassium ion dependent and is mediated by LD surface proteins, J. Virol. 86 (2012) X.W. Chen, Cytosolic phospholipase A2 gamma is involved in hepatitis C virus
2096–2108. replication and assembly, J. Virol. 86 (2012) 13025–13037.

[7] W. Cheung, M. Gill, A. Esposito, C.F. Kaminski, N. Courousse, S. Chwetzoff, [28] Q.X. Han, C.L. Xu, C.C. Wu, W.B. Zhu, R.G. Yang, X.W. Chen, Compensatory
G. Trugnan, N. Keshavan, A. Lever, U. Desselberger, Rotaviruses associate with mutations in NS3 and NS5A proteins enhance the virus production capability of
cellular lipid droplet components to replicate in viroplasms, and compounds hepatitis C reporter virus, Virus Res. 145 (2009) 63–73.
disrupting or blocking lipid droplets inhibit viroplasm formation and viral
replication, J. Virol. 84 (2010) 6782–6798. [29] H.J. Kempen, A.P. Imbach, T. Giller, W.J. Neumann, U. Hennes, N. Nakada,
Secretion of apolipoprotein-a-I and apolipoprotein-B by Hepg2 cells - regulation by
[8] D.A. Gross, D.L. Silver, Cytosolic lipid droplets: from mechanisms of fat storage to substrates and metabolic-inhibitors, J. Lipid Res. 36 (1995) 1796–1806.
disease, Crit. Rev. Biochem. Mol. Biol. 49 (2014) 304–326.
[30] M. Guo, R.J. Pei, Q. Yang, H. Cao, Y. Wang, C.C. Wu, J.Z. Chen, Y. Zhou, X. Hu,
[9] M. Mori, H. Itabe, Y. Higashi, Y. Fujimoto, M. Shiomi, M. Yoshizumi, Y. Ouchi, M.J. Lu, X.W. Chen, Phosphatidylserine-specific phospholipase A1 involved in
T. Takano, Foam cell formation containing lipid droplets enriched with free hepatitis C virus assembly through NS2 complex formation, J. Virol. 89 (2015)
cholesterol by hyperlipidemic serum, J. Lipid Res. 42 (2001) 1771–1781. 2367–2377.

[10] R.A. Igal, R.A. Coleman, Neutral lipid storage disease: a genetic disorder with [31] S.M. Lam, G.H. Chua, X.J. Li, B. Su, G. Shui, Biological relevance of fatty acyl
abnormalities in the regulation of phospholipid metabolism, J. Lipid Res. 39 (1998) heterogeneity to the neural membrane dynamics of rhesus macaques during
31–43. normative aging, Oncotarget 7 (2016) 55970–55989.

[11] S. Le Lay, I. Dugail, Connecting lipid droplet biology and the metabolic syndrome, [32] S.M. Lam, L. Tong, X.R. Duan, A. Petznick, M.R. Wenk, G.H. Shui, Extensive
Prog. Lipid Res. 48 (2009) 191–195. characterization of human tear fluid collected using different techniques unravels
the presence of novel lipid amphiphiles, J. Lipid Res. 55 (2014) 289–298.

[33] G.H. Shui, X.L. Guan, C.P. Low, G.H. Chua, J.S.Y. Goh, H.Y. Yang, M.R. Wenk,
Toward one step analysis of cellular lipidomes using liquid chromatography
coupled with mass spectrometry: application to Saccharomyces cerevisiae and
Schizosaccharomyces pombe lipidomics, Mol. BioSyst. 6 (2010) 1008–1017.

[34] S. Li, K. Zhao, S. Liu, C. Wu, Y. Yao, L. Cao, X. Hu, Y. Zhou, Y. Wang, R. Pei, M. Lu,
X. Chen, HBsAg sT123N mutation induces stronger antibody responses to HBsAg
and HBcAg and accelerates in vivo HBsAg clearance, Virus Res. 210 (2015)
119–125.

[35] J. Folch, M. Lees, G.H. Sloane Stanley, A simple method for the isolation and
purification of total lipides from animal tissues, J. Biol. Chem. 226 (1957) 497–509.

[36] L.L. Listenberger, A.G. Ostermeyer-Fay, E.B. Goldberg, W.J. Brown, D.A. Brown,
Adipocyte differentiation-related protein reduces the lipid droplet association of
adipose triglyceride lipase and slows triacylglycerol turnover, J. Lipid Res. 48
(2007) 2751–2761.

[37] K. Asai, T. Hirabayashi, T. Houjou, N. Uozumi, R. Taguchi, T. Shimizu, Human
group IVC phospholipase A2 (cPLA2gamma). Roles in the membrane remodeling
and activation induced by oxidative stress, J. Biol. Chem. 278 (2003) 8809–8814.

[38] A. Yamashita, K. Tanaka, R. Kamata, T. Kumazawa, N. Suzuki, H. Koga, K. Waku,
T. Sugiura, Subcellular localization and lysophospholipase/transacylation activities
of human group IVC phospholipase A2 (cPLA2gamma), Biochim. Biophys. Acta
1791 (2009) 1011–1022.

704

X. Su et al. BBA - Molecular and Cell Biology of Lipids 1862 (2017) 692–705

[39] H. Robenek, O. Hofnagel, I. Buers, M.J. Robenek, D. Troyer, N.J. Severs, [50] K. Ishihara, K. Tachibana, A. Kuroda, A. Terakawa, S. Baba, S. Kanai, S. Akiba,
Adipophilin-enriched domains in the ER membrane are sites of lipid droplet Triacylglycerol deposition with group IVC phospholipase A2 expression in oleate-
biogenesis, J. Cell Sci. 119 (2006) 4215–4224. and linoleate-stimulated Huh-7 hepatocytes, Biol. Pharm. Bull. 34 (2011) 191–196.

[40] D.L. Brasaemle, T. Barber, N.E. Wolins, G. Serrero, E.J. BlanchetteMackie, [51] C. Guijas, G. Perez-Chacon, A.M. Astudillo, J.M. Rubio, L. Gil-de-Gomez,
C. Londos, Adipose differentiation-related protein is an ubiquitously expressed lipid M.A. Balboa, J. Balsinde, Simultaneous activation of p38 and JNK by arachidonic
storage droplet-associated protein, J. Lipid Res. 38 (1997) 2249–2263. acid stimulates the cytosolic phospholipase A2-dependent synthesis of lipid droplets
in human monocytes, J. Lipid Res. 53 (2012) 2343–2354.
[41] K.W. Underwood, C.Z. Song, R.W. Kriz, X.J. Chang, J.L. Knopf, L.L. Lin, A novel
calcium-independent phospholipase A(2), cPLA(2)-gamma, that is prenylated and [52] R.E. Wooten, M.C. Willingham, L.W. Daniel, C.C. Leslie, L.C. Rogers, S. Sergeant,
contains homology to cPLA(2), J. Biol. Chem. 273 (1998) 21926–21932. J.T. O'Flaherty, Novel translocation responses of cytosolic phospholipase A2alpha
fluorescent proteins, Biochim. Biophys. Acta 1783 (2008) 1544–1550.
[42] V. Brass, E. Bieck, R. Montserret, B. Wolk, J.A. Hellings, H.E. Blum, F. Penin,
D. Moradpour, An amino-terminal amphipathic alpha-helix mediates membrane [53] L.S. Moreira, B. Piva, L.B. Gentile, F.P. Mesquita-Santos, H. D'Avila, C.M. Maya-
association of the hepatitis C virus nonstructural protein 5A, J. Biol. Chem. 277 Monteiro, P.T. Bozza, C. Bandeira-Melo, B.L. Diaz, Cytosolic phospholipase A2-
(2002) 8130–8139. driven PGE2 synthesis within unsaturated fatty acids-induced lipid bodies of
epithelial cells, Biochim. Biophys. Acta 1791 (2009) 156–165.
[43] E. Santolini, L. Pacini, C. Fipaldini, G. Migliaccio, N. Lamonica, The Ns2 protein of
hepatitis-C virus is a transmembrane polypeptide, J. Virol. 69 (1995) 7461–7471. [54] R.T. Pickard, B.A. Strifler, R.M. Kramer, J.D. Sharp, Molecular cloning of two new
human paralogs of 85-kDa cytosolic phospholipase A(2), J. Biol. Chem. 274 (1999)
[44] R. Bartenschlager, V. Lohmann, F. Penin, The molecular and structural basis of 8823–8831.
advanced antiviral therapy for hepatitis C virus infection, Nat. Rev. Microbiol. 11
(2013) 482–496. [55] M. Murakami, S. Masuda, I. Kudo, Arachidonate release and prostaglandin
production by group IVC phospholipase A2 (cytosolic phospholipase A2gamma),
[45] A. Stewart, M. Ghosh, D.M. Spencer, C.C. Leslie, Enzymatic properties of human Biochem. J. 372 (2003) 695–702.
cytosolic phospholipase A(2)gamma, J. Biol. Chem. 277 (2002) 29526–29536.
[56] D.E. Tucker, A. Stewart, L. Nallan, P. Bendale, F. Ghomashchi, M.H. Gelb,
[46] C.D. Anfuso, G. Lupo, L. Romeo, G. Giurdanella, C. Motta, A. Pascale, C. Tirolo, C.C. Leslie, Group IVC cytosolic phospholipase A(2) gamma is farnesylated and
B. Marchetti, M. Alberghina, Endothelial cell-pericyte cocultures induce PLA2 palmitoylated in mammalian cells, J. Lipid Res. 46 (2005) 2122–2133.
protein expression through activation of PKCalpha and the MAPK/ERK cascade, J.
Lipid Res. 48 (2007) 782–793. [57] G.E. Tusnady, I. Simon, The HMMTOP transmembrane topology prediction server,
Bioinformatics 17 (2001) 849–850.
[47] C. Guijas, J.P. Rodriguez, J.M. Rubio, M.A. Balboa, J. Balsinde, Phospholipase A2
regulation of lipid droplet formation, Biochim. Biophys. Acta 1841 (2014) [58] S. Moller, M.D. Croning, R. Apweiler, Evaluation of methods for the prediction of
1661–1671. membrane spanning regions, Bioinformatics 17 (2001) 646–653.

[48] T.A. Lagace, N.D. Ridgway, The role of phospholipids in the biological activity and [59] Y. Bian, C. Song, K. Cheng, M. Dong, F. Wang, J. Huang, D. Sun, L. Wang, M. Ye,
structure of the endoplasmic reticulum, Biochim. Biophys. Acta, Mol. Cell Res. 1833 H. Zou, An enzyme assisted RP-RPLC approach for in-depth analysis of human liver
(2013) 2499–2510. phosphoproteome, J. Proteome 96 (2014) 253–262.

[49] F. Wilfling, J.T. Haas, T.C. Walther, R.V. Farese, Lipid droplet biogenesis, Curr. [60] F. Negro, A.J. Sanyal, Hepatitis C virus, steatosis and lipid abnormalities: clinical
Opin. Cell Biol. 29 (2014) 39–45. and pathogenic data, Liver Int. 29 (2009) 26–37.

705

点击阅读翻页书版本